Stem-loop sequence bta-mir-1434

AccessionMI0011514 (change log)
DescriptionBos taurus miR-1434 stem-loop
Gene family MIPF0000775; mir-1434
Literature search

2 open access papers mention bta-mir-1434
(2 sentences)

Stem-loop
          uacaugau    -aaa         cuuu a  u 
5' caccuug        gacu    auuucuuca    g cc g
   |||||||        ||||    |||||||||    | ||  
3' guggagu        cugg    uaaagaagu    c gg a
          --------    aauc         -uau -  u 
Get sequence
Deep sequencing
110 reads, 0 reads per million, 39 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 21336498-21336570 [+]
sense
ENSBTAT00000005581 ; EEF2-201; intron 4
Database links

Mature sequence bta-miR-1434-5p

Accession MIMAT0012039
Previous IDsbta-miR-1434*
Sequence

7 - 

guacaugaugacuaaaauuucu

 - 28

Get sequence
Deep sequencing23 reads, 20 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence bta-miR-1434-3p

Accession MIMAT0012040
Previous IDsbta-miR-1434
Sequence

51 - 

gaagaaaucuaaggucugagg

 - 71

Get sequence
Deep sequencing84 reads, 36 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).