Stem-loop sequence bta-mir-2480

AccessionMI0011542 (change log)
DescriptionBos taurus miR-2480 stem-loop
Stem-loop
   u   -     u     u     uuau  c   aa 
5'  ugg guaaa uguau guuuc    ga aac  u
    ||| ||||| ||||| |||||    || |||  a
3'  auc cguuu acaua caaag    cu uug  g
   a   a     u     -     -ugu  a   ac 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr9: 91772145-91772212 [-]
intergenic
Database links

Mature sequence bta-miR-2480

Accession MIMAT0012072
Sequence

9 - 

auuguauuguuucuuaugac

 - 28

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).