Stem-loop sequence sme-mir-2c

AccessionMI0005134 (change log)
DescriptionSchmidtea mediterranea miR-2c stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
   uuuc   uu     -acaaaa       -a     u    u     u 
5'     uuu  caaau       aucauca  uuugg cugu auaaa g
       |||  |||||       |||||||  ||||| |||| ||||| g
3'     aaa  guuua       uaguagu  aaacc gaca uauuu c
   -uac   cu     aauauuc       ca     -    c     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig297: 116024-116116 [-]
intergenic
Clustered miRNAs
< 10kb from sme-mir-2c
sme-mir-71cContig297: 116135-116216 [-]
sme-mir-2cContig297: 116024-116116 [-]
Database links

Mature sequence sme-miR-2c-5p

Accession MIMAT0012094
Sequence

20 - 

aaucaucaauuuggucuguuaua

 - 42

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

Mature sequence sme-miR-2c-3p

Accession MIMAT0003967
Previous IDssme-miR-2c
Sequence

54 - 

ucacagccaaaacugaugaucu

 - 75

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).