Stem-loop sequence sme-mir-8a

AccessionMI0005139 (change log)
Previous IDssme-mir-8
DescriptionSchmidtea mediterranea miR-8a stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
       a     -a   a      uua   cagaau 
5' aaug caucg  auc gacagu   aga      u
   |||| |||||  ||| ||||||   |||      u
3' uuac guagc  ugg cuguca   ucu      a
       c     aa   a      uaa   aaaaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig1018: 3846-3915 [+]
intergenic
Database links

Mature sequence sme-miR-8a-5p

Accession MIMAT0012099
Previous IDssme-miR-8a*
Sequence

4 - 

gacaucgaaucagacaguuua

 - 24

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

Mature sequence sme-miR-8a-3p

Accession MIMAT0003972
Previous IDssme-miR-8;sme-miR-8a
Sequence

45 - 

uaauacugucagguaacgaugcc

 - 67

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).