Stem-loop sequence ath-MIR1886

AccessionMI0008303 (change log)
DescriptionArabidopsis thaliana miR1886 stem-loop
Literature search

1 open access papers mention ath-MIR1886
(2 sentences)

Stem-loop
   ga     a                         a      auguagacgaugcuau 
5'   gugag gaagugagaugaaaucuuugauugg aauuuc                c
     ||||| ||||||||||||||||||||||||| ||||||                 
3'   uacuc cuucauucuacuuuagaaauuaacc uuaaag                a
   -g     c                         c      aaaaccaguauacccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 15611870-15611982 [+]
intergenic
Database links

Mature sequence ath-miR1886.1

Accession MIMAT0007853
Previous IDsath-miR1886
Sequence

4 - 

ugagagaagugagaugaaauc

 - 24

Get sequence
Evidence experimental; PARE [1]

Mature sequence ath-miR1886.2

Accession MIMAT0012129
Sequence

13 - 

ugagaugaaaucuuugauugg

 - 33

Get sequence
Evidence experimental; Illumina [2]

Mature sequence ath-miR1886.3

Accession MIMAT0013773
Sequence

84 - 

aauuaaagauuucaucuuacu

 - 104

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:18542052 "Global identification of microRNA-target RNA pairs by parallel analysis of RNA ends" German MA, Pillay M, Jeong DH, Hetawal A, Luo S, Janardhanan P, Kannan V, Rymarquis LA, Nobuta K, German R, De Paoli E, Lu C, Schroth G, Meyers BC, Green PJ Nat Biotechnol. 26:941-946(2008).
2
PMID:19307293 "Computational and analytical framework for small RNA profiling by high-throughput sequencing" Fahlgren N, Sullivan CM, Kasschau KD, Chapman EJ, Cumbie JS, Montgomery TA, Gilbert SD, Dasenko M, Backman TW, Givan SA, Carrington JC RNA. 15:992-1002(2009).