Stem-loop sequence dme-mir-2489

AccessionMI0011578 (change log)
DescriptionDrosophila melanogaster miR-2489 stem-loop
Gene family MIPF0000953; mir-2489
Stem-loop
   -  a  aaguu    - ug    ug  u      au   - --      g 
5'  gc au     agac g  agua  gc auacaa  cau c  uggaac u
    || ||     |||| |  ||||  || ||||||  ||| |  ||||||  
3'  cg ua     uuug c  uuau  ug uauguu  gua g  aucuug a
   a  a  -guau    a gu    gu  -      au   u ua      a 
Get sequence
Deep sequencing
458 reads, 0 reads per million, 37 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 13609974-13610068 [+]
sense
FBtr0080509 ; kuz-RA; 3'UTR (exon 5)
FBtr0080510 ; kuz-RB; 3'UTR (exon 5)
FBtr0100660 ; kuz-RC; 3'UTR (exon 5)
FBtr0301412 ; kuz-RF; 3'UTR (exon 5)
FBtr0112886 ; kuz-RD; 3'UTR (exon 6)
Database links

Mature sequence dme-miR-2489-5p

Accession MIMAT0020910
Sequence

5 - 

uaaguuagacgugaguauggcuauacaaa

 - 33

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence not experimental

Mature sequence dme-miR-2489-3p

Accession MIMAT0012196
Previous IDsdme-miR-2489
Sequence

62 - 

uauuguauguuguauuugcagu

 - 83

Get sequence
Deep sequencing451 reads, 37 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).