Stem-loop sequence dme-mir-2493

AccessionMI0011582 (change log)
DescriptionDrosophila melanogaster miR-2493 stem-loop
Stem-loop
   c   auua   a   cc       -  a    --c      a      ------   a 
5'  gcu    uua aac  ccaacgc uc caca   acacac gccaug      ugc u
    |||    ||| |||  ||||||| || ||||   |||||| ||||||      ||| g
3'  cga    agu uug  gguugcg ag gugu   ugugug cgguau      acg g
   -   --cc   c   -c       g  c    uua      c      caaaaa   a 
Get sequence
Deep sequencing
158 reads, 0 reads per million, 32 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 15130754-15130859 [-]
sense
FBtr0303485 ; CG42788-RC; intron 1
FBtr0303486 ; CG42788-RB; intron 1
Database links

Mature sequence dme-miR-2493-5p

Accession MIMAT0012200
Previous IDsdme-miR-2493*
Sequence

23 - 

gcucacacacacacacagcca

 - 43

Get sequence
Deep sequencing21 reads, 13 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence dme-miR-2493-3p

Accession MIMAT0012201
Previous IDsdme-miR-2493
Sequence

68 - 

ccguguguauuugugcgaggcgu

 - 90

Get sequence
Deep sequencing134 reads, 24 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).