Stem-loop sequence dps-mir-311

AccessionMI0011603 (change log)
DescriptionDrosophila pseudoobscura miR-311 stem-loop
Gene family MIPF0000566; mir-310
Stem-loop
   -g  u     uguu      a   c    a  ug -   a  g         -  uug 
5'   ug auucg    cggugg uac uuca gc  g ggg ug gcaauacug ug   u
     || |||||    |||||| ||| |||| ||  | ||| || ||||||||| ||    
3'   ac ugggu    gucauc gug aagu cg  c ccc ac cguuaugac ac   a
   ca  u     ---c      c   a    c  gu a   -  a         c  uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
3: 8679717-8679827 [+]
intergenic
Clustered miRNAs
< 10kb from dps-mir-311
dps-mir-25513: 8678482-8678601 [+]
dps-mir-25523: 8679230-8679342 [+]
dps-mir-3113: 8679717-8679827 [+]
dps-mir-92c3: 8679866-8679980 [+]
dps-mir-25533: 8680021-8680129 [+]
dps-mir-25063: 8680187-8680303 [+]
dps-mir-25543: 8680335-8680451 [+]
dps-mir-2507a3: 8680507-8680614 [+]
dps-mir-2507b3: 8680663-8680779 [+]
Database links

Mature sequence dps-miR-311-5p

Accession MIMAT0012241
Previous IDsdps-miR-311*
Sequence

28 - 

aagcugggggaugggcaauacu

 - 49

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-311-3p

Accession MIMAT0012242
Previous IDsdps-miR-311
Sequence

67 - 

uauugcacacccacuggccuga

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).