Stem-loop sequence dps-mir-92c

AccessionMI0011604 (change log)
DescriptionDrosophila pseudoobscura miR-92c stem-loop
Stem-loop
   -  ggaag g   au  a  --    -   a   gua     u    cu     a    gau 
5'  gc     g ugc  cg gc  ugcu uug uuu   ggccg gguu  ugcaa uacg   u
    ||     | |||  || ||  |||| ||| |||   ||||| ||||  ||||| ||||   c
3'  cg     c acg  gc cg  acga aac aaa   cuggc ccga  acguu augc   a
   a  ----a a   --  -  ca    u   a   aac     c    uc     -    aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
3: 8679866-8679980 [+]
intergenic
Clustered miRNAs
< 10kb from dps-mir-92c
dps-mir-25513: 8678482-8678601 [+]
dps-mir-25523: 8679230-8679342 [+]
dps-mir-3113: 8679717-8679827 [+]
dps-mir-92c3: 8679866-8679980 [+]
dps-mir-25533: 8680021-8680129 [+]
dps-mir-25063: 8680187-8680303 [+]
dps-mir-25543: 8680335-8680451 [+]
dps-mir-2507a3: 8680507-8680614 [+]
dps-mir-2507b3: 8680663-8680779 [+]
Database links

Mature sequence dps-miR-92c-5p

Accession MIMAT0012243
Previous IDsdps-miR-92c*
Sequence

33 - 

aggccgugguucuugcaaauacg

 - 55

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-92c-3p

Accession MIMAT0012244
Previous IDsdps-miR-92c
Sequence

67 - 

uauugcacuagccccgguccaa

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).