Stem-loop sequence dps-mir-959

AccessionMI0011611 (change log)
DescriptionDrosophila pseudoobscura miR-959 stem-loop
Gene family MIPF0000910; mir-959
Stem-loop
   ------uuuu     g uu       - u         g u        a ca    u 
5'           guuuu g  cuauguu c uaguacuug g ugauaaag c  cucg a
             ||||| |  ||||||| | ||||||||| | |||||||| |  |||| g
3'           cgaaa c  gauacaa g auuaugggc c acuguuuc g  gagu u
   uaaaacaacg     a uc       c u         g u        c aa    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
4_group4: 3182613-3182724 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-959
dps-mir-9594_group4: 3182613-3182724 [-]
dps-mir-25634_group4: 3182462-3182572 [-]
dps-mir-25094_group4: 3182231-3182330 [-]
dps-mir-9644_group4: 3181504-3181621 [-]
Database links

Mature sequence dps-miR-959-5p

Accession MIMAT0012257
Previous IDsdps-miR-959*
Sequence

22 - 

uuaguacuuggguugauaaaga

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-959-3p

Accession MIMAT0012258
Previous IDsdps-miR-959
Sequence

66 - 

uugucaucgcggguauuaugca

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).