Stem-loop sequence dps-mir-2574b

AccessionMI0011650 (change log)
DescriptionDrosophila pseudoobscura miR-2574b stem-loop
Gene family MIPF0001029; mir-2574
Stem-loop
   a                   g         uug 
5'  auuucuggucucuccauuu guauugcgu   u
    ||||||||||||||||||| |||||||||   u
3'  uaaagaccagagagguaaa cauaacgca   g
   -                   a         uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
Unknown_singleton_1172: 1127-1194 [+]
intergenic
Database links

Mature sequence dps-miR-2574b

Accession MIMAT0012305
Sequence

43 - 

caauacaaaauggagagaccag

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).