Stem-loop sequence dps-mir-2542-1

AccessionMI0011677 (change log)
DescriptionDrosophila pseudoobscura miR-2542-1 stem-loop
Gene family MIPF0000889; mir-2542
Stem-loop
        u   u  g     u    -  ga        u  aau 
5' gggcu aua uu uauuu ugcu cg  cauuuaug ac   u
   ||||| ||| || ||||| |||| ||  |||||||| ||   u
3' cccga uau aa auaaa acga gu  guagauac ug   g
        u   u  g     u    c  ug        -  cga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
XL_group1e: 8373614-8373698 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-2542-1
dps-mir-2543b-1XL_group1e: 8380575-8380690 [-]
dps-mir-2517-3XL_group1e: 8380430-8380532 [-]
dps-mir-2544XL_group1e: 8378925-8379029 [-]
dps-mir-2542-3XL_group1e: 8378579-8378663 [-]
dps-mir-2543b-2XL_group1e: 8378173-8378288 [-]
dps-mir-2517-2XL_group1e: 8378028-8378132 [-]
dps-mir-2524XL_group1e: 8377507-8377599 [-]
dps-mir-2542-2XL_group1e: 8376961-8377045 [-]
dps-mir-2524XL_group1e: 8376659-8376751 [-]
dps-mir-2543a-2XL_group1e: 8373978-8374093 [-]
dps-mir-2542-1XL_group1e: 8373614-8373698 [-]
dps-mir-2541XL_group1e: 8367679-8367786 [-]
dps-mir-2540XL_group1e: 8367333-8367441 [-]
dps-mir-2523XL_group1e: 8366995-8367108 [-]
dps-mir-2539XL_group1e: 8366678-8366788 [-]
dps-mir-2522aXL_group1e: 8365900-8366011 [-]
Database links

Mature sequence dps-miR-2542-5p

Accession MIMAT0012340
Previous IDsdps-miR-2542
Sequence

14 - 

uauuuuugcucggacauuuaugu

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-2542-3p

Accession MIMAT0012341
Previous IDsdps-miR-2542*
Sequence

52 - 

uagaugguugcagcauaaauaga

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).