Stem-loop sequence dps-mir-2545a

AccessionMI0011687 (change log)
DescriptionDrosophila pseudoobscura miR-2545a stem-loop
Gene family MIPF0000994; mir-2545
Stem-loop
           a              c       c        a      --auu    aua 
5' uccuccuc aggaggaaauucuu uacugcg gagggcau gggcag     cuca   u
   |||||||| |||||||||||||| ||||||| |||||||| ||||||     ||||    
3' aggaggag uccuccuuuaagaa augacgc cucccgua ccuguc     gggu   u
           c              c       a        g      gucuc    ccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
XL_group1e: 1655246-1655363 [+]
intergenic
XL_group1e: 1655518-1655635 [+]
intergenic
XL_group1e: 1655790-1655907 [+]
intergenic
XL_group1e: 1656062-1656179 [+]
intergenic
XL_group1e: 1656334-1656451 [+]
intergenic
XL_group1e: 1659621-1659738 [+]
intergenic
Clustered miRNAs
< 10kb from dps-mir-2545a
dps-mir-2545aXL_group1e: 1655246-1655363 [+]
dps-mir-2545aXL_group1e: 1655518-1655635 [+]
dps-mir-2545aXL_group1e: 1655790-1655907 [+]
dps-mir-2545aXL_group1e: 1656062-1656179 [+]
dps-mir-2545aXL_group1e: 1656334-1656451 [+]
dps-mir-2545bXL_group1e: 1656606-1656722 [+]
dps-mir-2545aXL_group1e: 1659621-1659738 [+]
Database links

Mature sequence dps-miR-2545a-5p

Accession MIMAT0012350
Previous IDsdps-miR-2545a
Sequence

17 - 

aauucuucuacugcgcgaggg

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-2545a-3p

Accession MIMAT0012351
Previous IDsdps-miR-2545a*
Sequence

84 - 

cucacgcaguacaagaauuuc

 - 104

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).