Stem-loop sequence dps-mir-2562

AccessionMI0011706 (change log)
DescriptionDrosophila pseudoobscura miR-2562 stem-loop
Stem-loop
   --         --u     -uauu   c  -  u 
5'   gcaagucaa   aagau     cca au ca u
     |||||||||   |||||     ||| || ||  
3'   cguuuaguu   uucua     ggu ua gu a
   ga         cac     caauu   a  u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
4_group4: 697493-697556 [-]
intergenic
Database links

Mature sequence dps-miR-2562-5p

Accession MIMAT0012386
Previous IDsdps-miR-2562*
Sequence

1 - 

gcaagucaauaagauuauuc

 - 20

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-2562-3p

Accession MIMAT0012387
Previous IDsdps-miR-2562
Sequence

41 - 

uuaacaucuucacuugauuugcag

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).