Stem-loop sequence dps-mir-2574a

AccessionMI0011723 (change log)
DescriptionDrosophila pseudoobscura miR-2574a stem-loop
Gene family MIPF0001029; mir-2574
Stem-loop
   ugugaaucuuucuuccagguucuu           a                    aua 
5'                         ccaauuucugg cucuccauuuuguauugcgu   c
                           ||||||||||| ||||||||||||||||||||   a
3'                         gguuaaagacc gagagguaaaacauaacgca   a
   --------acaauugaauaauggu           a                    aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
Unknown_group_61: 9898-10010 [+]
intergenic
Unknown_group_61: 25363-25475 [+]
intergenic
Database links

Mature sequence dps-miR-2574a-5p

Accession MIMAT0012418
Previous IDsdps-miR-2574a
Sequence

33 - 

uggacucuccauuuuguauugcg

 - 55

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-2574a-3p

Accession MIMAT0012419
Previous IDsdps-miR-2574a*
Sequence

69 - 

caauacaaaauggagagaccag

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).