Stem-loop sequence dsi-mir-999

AccessionMI0011746 (change log)
DescriptionDrosophila simulans miR-999 stem-loop
Gene family MIPF0000852; mir-999
Stem-loop
     a  cc   --        cc         g      g       u  au 
5' gg ug  gcu  caauuacc  gacauaguc uacggu aauguug gu  u
   || ||  |||  ||||||||  ||||||||| |||||| ||||||| ||  g
3' cc ac  cga  guuggugg  cugugucag auguca uuguaac ca  g
     g  -c   cc        cu         a      a       -  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr3R: 17429603-17429703 [-]
intergenic
Database links

Mature sequence dsi-miR-999-5p

Accession MIMAT0012455
Previous IDsdsi-miR-999*
Sequence

22 - 

acauagucguacggugaauguug

 - 44

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dsi-miR-999-3p

Accession MIMAT0012456
Previous IDsdsi-miR-999
Sequence

60 - 

uguuaacuguaagacugugucu

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).