Stem-loop sequence dsi-mir-2489

AccessionMI0011779 (change log)
DescriptionDrosophila simulans miR-2489 stem-loop
Gene family MIPF0000953; mir-2489
Stem-loop
   -  a  aaguu    - ug    ug  u      au   - --      a 
5'  gc au     agac g  agua  gc auacaa  cau c  uggaac u
    || ||     |||| |  ||||  || ||||||  ||| |  ||||||  
3'  cg ua     uuug c  uuau  ug uauguu  gua g  aucuug a
   a  a  -guau    a gu    gu  -      au   c ua      c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr2L: 13379254-13379348 [+]
intergenic
Database links

Mature sequence dsi-miR-2489

Accession MIMAT0012510
Sequence

62 - 

uauuguauguuguauuugcagu

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).