Stem-loop sequence hvt-mir-H4

AccessionMI0012476 (change log)
DescriptionHerpesvirus of turkeys miR-H4 stem-loop
Stem-loop
   --------     a  u   a   g  g  auau     ga 
5'         ggcgg gg gug uau gu ug    ggugu  u
           ||||| || ||| ||| || ||    |||||  a
3'         cugcc cc cac gug cg gc    ccgua  u
   caaugagg     g  -   g   g  g  guau     ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvt-miR-H4-5p

Accession MIMAT0012714
Previous IDshvt-miR-H4
Sequence

1 - 

ggcggaggugugauauggugu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence hvt-miR-H4-3p

Accession MIMAT0012715
Previous IDshvt-miR-H4*
Sequence

49 - 

gggcgguggcacccgccgucggagua

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19328516 "MicroRNAs of Gallid and Meleagrid herpesviruses show generally conserved genomic locations and are virus-specific" Waidner LA, Morgan RW, Anderson AS, Bernberg EL, Kamboj S, Garcia M, Riblet SM, Ouyang M, Isaacs GK, Markis M, Meyers BC, Green PJ, Burnside J Virology. 388:128-136(2009).