Stem-loop sequence oan-mir-92c

AccessionMI0012555 (change log)
DescriptionOrnithorhynchus anatinus miR-92c stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   u   au       g    c    ga       uuu 
5'  ucu  gcagguu ggau agug  aaugcug   g
    |||  ||||||| |||| ||||  |||||||    
3'  aga  uguccga ccug ucac  uuauggu   c
   u   gu       a    u    -g       uuc 
Get sequence
Deep sequencing
66 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
1: 9665143-9665213 [-]
intergenic
Database links

Mature sequence oan-miR-92c

Accession MIMAT0012797
Sequence

44 - 

uauugcacuuguccaagccugu

 - 65

Get sequence
Deep sequencing61 reads, 5 experiments
Evidence not experimental

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).