Stem-loop sequence ptr-mir-631

AccessionMI0012574 (change log)
DescriptionPan troglodytes miR-631 stem-loop
Gene family MIPF0000508; mir-631
Stem-loop
   gu      cc    ua a      cg  a  -      a 
5'   ggggag  uggu  g ccuggc  ag cc ucagcu c
     ||||||  ||||  | ||||||  || || |||||| a
3'   ccucuc  accg  c ggacug  uc gg agucga c
   --      ac    -- -      ag  a  u      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr15: 56344289-56344363 [-]
antisense
ENSPTRT00000013470 ; NEIL1-201; intron 5
Database links

Mature sequence ptr-miR-631

Accession MIMAT0012812
Sequence

16 - 

agaccuggccgagaccucagc

 - 36

Get sequence
Evidence not experimental
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).