Stem-loop sequence ptr-mir-661

AccessionMI0012576 (change log)
DescriptionPan troglodytes miR-661 stem-loop
Gene family MIPF0000465; mir-661
Stem-loop
   -----   agga    cu    u     g  --   g     cug     ug 
5'      ccc    gagg  gugc guggg ca  gac caggc   agccc  g
        |||    ||||  |||| ||||| ||  ||| |||||   |||||  u
3'      ggg    uucc  ugcg caccc gu  cug guccg   ucggg  u
   ucggu   ---g    ag    -     g  cu   g     ---     cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr8: 146719003-146719095 [-]
sense
ENSPTRT00000038241 ; PLEC-201; intron 1
Database links

Mature sequence ptr-miR-661

Accession MIMAT0012814
Sequence

55 - 

ugccugggucucuggcccacgcgu

 - 78

Get sequence
Evidence not experimental
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).