Stem-loop sequence eca-mir-490

AccessionMI0012698 (change log)
DescriptionEquus caballus miR-490 stem-loop
Gene family MIPF0000229; mir-490
Stem-loop
         c      --         g   cac   u 
5' ucgaca caugga  ucuccaggu ggu   guu a
   |||||| ||||||  ||||||||| |||   |||  
3' aguugu guaccu  ggaggucca cca   uag g
         c      ca         a   -ca   a 
Get sequence
Deep sequencing
119 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr4: 90776976-90777044 [+]
sense
ENSECAT00000028365 ; eca-mir-490-201; exon 1
Database links

Mature sequence eca-miR-490-5p

Accession MIMAT0012944
Sequence

7 - 

ccauggaucuccaggugggu

 - 26

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-490-3p

Accession MIMAT0012945
Sequence

44 - 

caaccuggaggacuccaugcug

 - 65

Get sequence
Deep sequencing118 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).