Stem-loop sequence eca-mir-92b

AccessionMI0012719 (change log)
DescriptionEquus caballus miR-92b stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention eca-mir-92b
(2 sentences)

Stem-loop
       g     ga       c            uucuu 
5' gggc ggagg  cgggacg ggugcaguguug     u
   |||| |||||  ||||||| ||||||||||||     c
3' cccg ccucc  gcccugc ucacguuauaac     c
       g     -g       -            cgccc 
Get sequence
Deep sequencing
4875 reads, 300 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr5: 42707135-42707209 [-]
intergenic
Database links

Mature sequence eca-miR-92b

Accession MIMAT0012966
Sequence

49 - 

uauugcacucgucccggccucc

 - 70

Get sequence
Deep sequencing4872 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).