Stem-loop sequence eca-mir-141

AccessionMI0012723 (change log)
DescriptionEquus caballus miR-141 stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
      u       --    u        -   ugg  ua 
5' ggg ccaucuu  ccag acaguguu gga   uc  a
   ||| |||||||  |||| |||||||| |||   ||  u
3' ccc gguagaa  gguc ugucacaa ccu   ag  u
      -       au    -        u   cga  ug 
Get sequence
Deep sequencing
31 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr6: 34423490-34423561 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-141
eca-mir-200cchr6: 34423081-34423144 [+]
eca-mir-141chr6: 34423490-34423561 [+]
Database links

Mature sequence eca-miR-141

Accession MIMAT0012970
Sequence

48 - 

uaacacugucugguaaagaugg

 - 69

Get sequence
Deep sequencing31 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).