Stem-loop sequence eca-mir-25

AccessionMI0012801 (change log)
DescriptionEquus caballus miR-25 stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention eca-mir-25
(1 sentences)

Stem-loop
       a ug   ag    g     uu g     u   --  ac 
5' ggcc g  uug  aggc gagac  g gcaau gcu  gg  g
   |||| |  |||  |||| |||||  | ||||| |||  ||  c
3' ccgg c  gac  ucug cucug  c cguua cgg  cc  u
       c gu   ag    g     uu a     -   gu  cg 
Get sequence
Deep sequencing
9385 reads, 600 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr13: 8034246-8034329 [-]
sense
ENSECAT00000015853 ; MCM7-201; intron 13
Clustered miRNAs
< 10kb from eca-mir-25
eca-mir-106bchr13: 8034691-8034749 [-]
eca-mir-93chr13: 8034465-8034523 [-]
eca-mir-25chr13: 8034246-8034329 [-]
Database links

Mature sequence eca-miR-25

Accession MIMAT0013057
Sequence

52 - 

cauugcacuugucucggucuga

 - 73

Get sequence
Deep sequencing9363 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).