Stem-loop sequence eca-mir-1301

AccessionMI0012815 (change log)
DescriptionEquus caballus miR-1301 stem-loop
Gene family MIPF0000742; mir-1301
Stem-loop
   u   g gg        -     - c      -  gu 
5'  gug g  gucacucu aggca c gcagca cu  g
    ||| |  |||||||| ||||| | |||||| ||  c
3'  cac c  uagugagg uccgu g cguugu gg  u
   a   a uu        g     c a      a  gg 
Get sequence
Deep sequencing
31 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr15: 70650469-70650540 [+]
intergenic
Database links

Mature sequence eca-miR-1301

Accession MIMAT0013070
Sequence

44 - 

uugcagcugccugggagugauuuc

 - 67

Get sequence
Deep sequencing31 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).