Stem-loop sequence eca-mir-92a

AccessionMI0012836 (change log)
DescriptionEquus caballus miR-92a stem-loop
Gene family MIPF0000013; mir-25
Literature search

5 open access papers mention eca-mir-92a
(10 sentences)

Stem-loop
               c   u           uu 
5' acagguugggau ggu gcaaugcugug  u
   |||||||||||| ||| |||||||||||   
3' uguccggcccug uca cguuaugguau  c
               u   -           gu 
Get sequence
Deep sequencing
32068 reads, 2.25e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr17: 61793120-61793180 [+]
sense
ENSECAT00000027951 ; eca-mir-92a-201; exon 1
Clustered miRNAs
< 10kb from eca-mir-92a
eca-mir-17chr17: 61792416-61792474 [+]
eca-mir-18achr17: 61792556-61792616 [+]
eca-mir-19achr17: 61792692-61792773 [+]
eca-mir-20achr17: 61792863-61792933 [+]
eca-mir-19bchr17: 61793002-61793065 [+]
eca-mir-92achr17: 61793120-61793180 [+]
Database links

Mature sequence eca-miR-92a

Accession MIMAT0013089
Sequence

40 - 

uauugcacuugucccggccugu

 - 61

Get sequence
Deep sequencing378363 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).