Stem-loop sequence eca-mir-381

AccessionMI0012894 (change log)
DescriptionEquus caballus miR-381 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
         a  c   g        u        --g   u 
5' uacuua ag gag uugcccuu guauauuc   guu a
   |||||| || ||| |||||||| ||||||||   |||  
3' augagu uc cuc aacgggaa cauauaag   cag u
         g  u   g        -        aua   u 
Get sequence
Deep sequencing
525 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42916054-42916128 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-381
eca-mir-495chr24: 42906084-42906165 [+]
eca-mir-3958chr24: 42908032-42908174 [+]
eca-mir-376cchr24: 42911104-42911169 [+]
eca-mir-376bchr24: 42911856-42911937 [+]
eca-mir-376achr24: 42912234-42912301 [+]
eca-mir-1185chr24: 42914351-42914436 [+]
eca-mir-381chr24: 42916054-42916128 [+]
eca-mir-487bchr24: 42916520-42916603 [+]
eca-mir-539chr24: 42917365-42917442 [+]
eca-mir-889chr24: 42917940-42918017 [+]
eca-mir-544-2chr24: 42918692-42918781 [+]
eca-mir-655chr24: 42919594-42919690 [+]
eca-mir-3959chr24: 42921540-42921650 [+]
eca-mir-487achr24: 42921992-42922071 [+]
eca-mir-382chr24: 42924862-42924937 [+]
eca-mir-134chr24: 42925245-42925315 [+]
eca-mir-485chr24: 42925986-42926058 [+]
Database links

Mature sequence eca-miR-381

Accession MIMAT0013149
Sequence

49 - 

uauacaagggcaagcucucugu

 - 70

Get sequence
Deep sequencing525 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).