Stem-loop sequence eca-mir-32

AccessionMI0012924 (change log)
DescriptionEquus caballus miR-32 stem-loop
Gene family MIPF0000069; mir-32
Literature search

1 open access papers mention eca-mir-32
(1 sentences)

Stem-loop
           ug     u            - uu  c 
5' ggagauau  cacau acuaaguugcac g  gu a
   ||||||||  ||||| |||||||||||| |  ||  
3' cuuuuaua  gugug ugauuuaacgug c  cg c
           gu     -            a uc  g 
Get sequence
Deep sequencing
46 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr25: 14424855-14424924 [-]
sense
ENSECAT00000008409 ; TMEM245-201; intron 17
Database links

Mature sequence eca-miR-32

Accession MIMAT0013180
Sequence

6 - 

uauugcacauuacuaaguugca

 - 27

Get sequence
Deep sequencing45 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).