Stem-loop sequence eca-mir-363

AccessionMI0012958 (change log)
DescriptionEquus caballus miR-363 stem-loop
Gene family MIPF0000138; mir-363
Literature search

1 open access papers mention eca-mir-363
(1 sentences)

Stem-loop
   u   gu         ca  a         --ga   gu 
5'  guu  cggguggau  cg ugcaauuuu    uua  a
    |||  |||||||||  || |||||||||    |||   
3'  caa  gucuaccua  gc acguuaaaa    gau  u
   c   au         ug  -         agag   aa 
Get sequence
Deep sequencing
8684 reads, 600 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 106691883-106691957 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-363
eca-mir-106achrX: 106692701-106692781 [-]
eca-mir-18bchrX: 106692551-106692609 [-]
eca-mir-20bchrX: 106692311-106692379 [-]
eca-mir-19b-2chrX: 106692173-106692268 [-]
eca-mir-92a-2chrX: 106692042-106692116 [-]
eca-mir-363chrX: 106691883-106691957 [-]
Database links

Mature sequence eca-miR-363

Accession MIMAT0013212
Sequence

50 - 

aauugcacgguauccaucugua

 - 71

Get sequence
Deep sequencing8683 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).