Stem-loop sequence mtr-MIR2588a

AccessionMI0011805 (change log)
DescriptionMedicago truncatula miR2588a stem-loop
Gene family MIPF0001030; MIR2588
Stem-loop
   -                         c                         aaaacauuuauuuucuuaaaacaaaacacuuaacacauuacauuaauguuacacucaacaauguuucaucgucuaacaugauugcacgcuuaaauuaaacuaaaaaaaacaacauguuacaaggauuguucacuuuacuugaauaaauaucaagc 
5'  agauagguccuuuaacuuuguaaca ugugcaacuaaguccuuccguuaac                                                                                                                                                           u
    ||||||||||||||||||||||||| |||||||||||||||||||||||||                                                                                                                                                            
3'  ucuauccaggaaauugaaacauugu auauguugauucaggaaggcaauug                                                                                                                                                           u
   g                         c                         aguggcaguuuuuuugcgacugcacugagacuucagacacuacaccguacguuuuccguuuuuguacaauaauuaaccuuuuacaauacuaauaaaaacuucuaacgacuacauugaacguacaacaaccgaaauugaacacaauaacguuguua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 7675732-7676146 [-]
intergenic
Database links

Mature sequence mtr-miR2588a

Accession MIMAT0013258
Sequence

21 - 

uaacacugugcaacuaagucc

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).