Stem-loop sequence mtr-MIR2588b

AccessionMI0011806 (change log)
DescriptionMedicago truncatula miR2588b stem-loop
Gene family MIPF0001030; MIR2588
Stem-loop
   -     a                   c                         aaaauauuuauuuucuuaaaacaaaacacuuaacacauuacauuaauguuacacucaacaauguuucaucgucuaacaugauugcacgcuuaaauuaaacuaaaaaaaacaacauguuacaaggauuauucacuuuacuugauuaaauaucaagc 
5'  agaua guccuuuaacuuuguaaca ugugcaacuaaguccuuccguuaac                                                                                                                                                           u
    ||||| ||||||||||||||||||| |||||||||||||||||||||||||                                                                                                                                                            
3'  ucuau caggaaauugaaacauugu auauguugauucaggaaggcaauug                                                                                                                                                           u
   g     c                   c                         aguggcaguuuuuuugcgacugcaccgacacuucagacacuacaccguacguuuuccguuuuuguacaauaauuaaccuuuuacaauacuaauaaaaacuucuaacgauuacauugaacguacaacaaccgaaauugaauacaauaacguuguua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 14068100-14068514 [-]
intergenic
Database links

Mature sequence mtr-miR2588b

Accession MIMAT0013259
Sequence

21 - 

uaacacugugcaacuaagucc

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).