Stem-loop sequence mtr-MIR2606a

AccessionMI0011857 (change log)
DescriptionMedicago truncatula miR2606a stem-loop
Gene family MIPF0000888; MIR2606
Stem-loop
   ---cgauua g                            c                       aa   ---aua     ug   auaa  a c   g 
5'          g agaaaacuuagguacaauuccuuaggug uuuucguaugguucuuaauuaaa  uac      uuuuu  gau    ca a uuu a
            | |||||||||||||||||||||||||||| |||||||||||||||||||||||  |||      |||||  |||    || | |||  
3'          c ucuuuugaauccauguuaaggaauccac aaaagcauaccaagaauugauuu  aug      aaaga  cua    gu u aaa g
   auuaguuua g                            a                       aa   guacua     gu   ---g  a u   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 23050085-23050271 [-]
intergenic
Database links

Mature sequence mtr-miR2606a

Accession MIMAT0013310
Sequence

21 - 

uacaauuccuuaggugcuuuu

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).