Stem-loop sequence mtr-MIR2606b

AccessionMI0011858 (change log)
DescriptionMedicago truncatula miR2606b stem-loop
Gene family MIPF0000888; MIR2606
Stem-loop
   a                          g        ug          u      uu   caugauuuccucaaaugcauaauuuu 
5'  ggagaaaacuuagguacaauuccuua gugcuuuu  uaugguucuu acuaaa  uac                          c
    |||||||||||||||||||||||||| ||||||||  |||||||||| ||||||  |||                           
3'  ccucuuuugaauccauguuaaggaau cacgaaaa  auaccaagaa ugauuu  aug                          u
   a                          a        gu          u      uu   uauaauaaaccuauauuguuugaaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 46561956-46562129 [-]
intergenic
Database links

Mature sequence mtr-miR2606b

Accession MIMAT0013311
Sequence

16 - 

uacaauuccuuaggugcuuuu

 - 36

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).