Stem-loop sequence mtr-MIR2646a

AccessionMI0011962 (change log)
DescriptionMedicago truncatula miR2646a stem-loop
Gene family MIPF0001010; MIR2646
Stem-loop
   -                     a            a                 u                   a         ccau           -ua                        --------------------      c  a 
5'  uuuucugauuuuauggucccc ugacauuuagug ugaugugucuguuuuuu aucaauuaaugugugccac uguguaauu    uuuuuaaaaaa   aaaaaaaugguauuuuucagauuu                    ccagca ua a
    ||||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||    |||||||||||   ||||||||||||||||||||||||                    |||||| || u
3'  gaaagacuaaaauaccagggg acuguaaauuac acuacacagacaaaaaa uaguuaauuacacacggug acacauuaa    aaaaauuuuuu   uuuuuuuaccauaaaaagucuaaa                    gguugu au u
   g                     c            g                 -                   c         -aau           uua                        acucucuuccuccgugcacu      u  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 28796917-28797205 [-]
intergenic
Database links

Mature sequence mtr-miR2646a

Accession MIMAT0013415
Sequence

21 - 

caugacauuuagugaugaugu

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).