Stem-loop sequence mtr-MIR2646b

AccessionMI0011963 (change log)
DescriptionMedicago truncatula miR2646b stem-loop
Gene family MIPF0001010; MIR2646
Stem-loop
   g                 a                 u                             cc       -a              g                ---------ca    uaaauu   u 
5'  ucccaugacauuuagug ugaugugucuguuuuuu aucaauuaaugugugccacguguguaauu  auuuuuu  aaaaauaaaaaaau guauuuuucagauuuu           gcac      cua u
    ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||  |||||||  |||||||||||||| ||||||||||||||||           ||||      |||  
3'  gggguacuguaaauuac acuacacagacaaaaaa uaguuaauuacacacgguguacacauuaa  uaaaaaa  uuuuuauuuuuuua cauaaaaagucuaaaa           cgug      ggu g
   a                 g                 -                             aa       aa              a                cucucuuccuc    --cacu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 3631562-3631816 [+]
intergenic
Database links

Mature sequence mtr-miR2646b

Accession MIMAT0013416
Sequence

5 - 

caugacauuuagugaugaugu

 - 25

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).