Stem-loop sequence cte-mir-2705

AccessionMI0012149 (change log)
DescriptionCapitella teleta miR-2705 stem-loop
Stem-loop
   aca      u g        -       -   guu    a   --u  c 
5'    ugcgcu u agguuggg agcacuu gcc   ugca aug   ug c
      |||||| | |||||||| ||||||| |||   |||| |||   ||  
3'    gcguga a uucaaccu ucgugaa ugg   acgu uac   ac u
   caa      u g        g       a   --a    c   uuu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Capca1; GCA_000328365.1) Overlapping transcripts
KB293301.1: 377031-377124 [+]
intergenic
Clustered miRNAs
< 10kb from cte-mir-2705
cte-mir-2705KB293301.1: 377031-377124 [+]
cte-mir-1987KB293301.1: 378001-378068 [+]
Database links

Mature sequence cte-miR-2705

Accession MIMAT0013571
Sequence

56 - 

ucugcaagguaaagugcugucca

 - 78

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755470 "MicroRNAs resolve an apparent conflict between annelid systematics and their fossil record" Sperling EA, Vinther J, Moy VN, Wheeler BM, Semon M, Briggs DE, Peterson KJ Proc Biol Sci. 276:4315-4322(2009).