Stem-loop sequence bhv1-mir-B4

AccessionMI0013176 (change log)
DescriptionBovine herpesvirus 1 miR-B4 stem-loop
Stem-loop
          c c   a   aga   u       ---a      
5' gcgcggc g gug ugu   ggg gacgcga    cggca 
   ||||||| | ||| |||   ||| |||||||    |||| g
3' cgcgccg c cac gcg   ccu cugcgcu    gccgc 
          a -   a   --g   u       cagg      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bhv1-miR-B4

Accession MIMAT0013965
Sequence

8 - 

cgcgugauguagagggugacg

 - 28

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19793906 "Characterization of microRNAs encoded by the bovine herpesvirus 1 genome" Glazov EA, Horwood PF, Assavalapsakul W, Kongsuwan K, Mitchell RW, Mitter N, Mahony TJ J Gen Virol. 91:32-41(2010).