Stem-loop sequence bhv1-mir-B5

AccessionMI0013177 (change log)
DescriptionBovine herpesvirus 1 miR-B5 stem-loop
Stem-loop
       ac       ------    g  g          ggucg 
5' ucgg  ucggagg      gcuc ga gacgacucuu     g
   ||||  |||||||      |||| || ||||||||||      
3' aguc  agccucc      cggg cu cugcugagaa     a
       -c       acgacu    g  g          gacug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bhv1-miR-B5

Accession MIMAT0013966
Sequence

6 - 

cucggagggcucggaggacgacuc

 - 29

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19793906 "Characterization of microRNAs encoded by the bovine herpesvirus 1 genome" Glazov EA, Horwood PF, Assavalapsakul W, Kongsuwan K, Mitchell RW, Mitter N, Mahony TJ J Gen Virol. 91:32-41(2010).