Stem-loop sequence zma-MIR827

AccessionMI0013242 (change log)
DescriptionZea mays miR827 stem-loop
Gene family MIPF0000726; MIR827
Literature search

18 open access papers mention zma-MIR827
(57 sentences)

Stem-loop
   -gu                           gcuucgaucgauggauuggugcaugcaugg 
5'    uuuguugguggucauuuaaccaugcau                              a
      |||||||||||||||||||||||||||                              u
3'    aaacgacuaccaguagauugguacgug                              u
   uac                           acuacgcgguguacguagugugauacguua 
Get sequence
Deep sequencing
12447 reads, 1.75e+03 reads per million, 151 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr5: 171268609-171268730 [-]
intergenic
Database links

Mature sequence zma-miR827-5p

Accession MIMAT0015365
Previous IDszma-miR827*
Sequence

3 - 

uuuguugguggucauuuaacc

 - 23

Get sequence
Deep sequencing2296 reads, 120 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence zma-miR827-3p

Accession MIMAT0014031
Previous IDszma-miR827
Sequence

101 - 

uuagaugaccaucagcaaaca

 - 121

Get sequence
Deep sequencing8851 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).