Stem-loop sequence osa-MIR2918

AccessionMI0013260 (change log)
DescriptionOryza sativa miR2918 stem-loop
Stem-loop
   ------  --    uuca       agaa     gauuauug      cugcaauuuuguugcacacuucugaugcuggagacagcugg 
5'       gu  aagc    ugggcaa    ggaug        gcaagc                                         g
         ||  ||||    |||||||    |||||        ||||||                                          
3'       ca  uucg    gucuguu    ccuac        cguuug                                         a
   uaggaa  au    ---c       -gug     ---auaua      aaugguacaaggguccuucgacccgugaguucccauaagaa 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 31091921-31092085 [-]
intergenic
Database links

Mature sequence osa-miR2918

Accession MIMAT0014049
Sequence

137 - 

auccguguugucugcgcuuua

 - 157

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:20131478 "Cloning and validation of novel miRNA from basmati rice indicates cross talk between abiotic and biotic stresses" Sanan-Mishra N, Kumar V, Sopory SK, Mukherjee SK Mol Genet Genomics. 282:463-474(2009).