Stem-loop sequence api-mir-281

AccessionMI0013360 (change log)
DescriptionAcyrthosiphon pisum miR-281 stem-loop
Gene family MIPF0000087; mir-46
Literature search

1 open access papers mention api-mir-281
(2 sentences)

Stem-loop
   ---        -ua     c      a  auu 
5'    aagagagc   uccgu gacagu ua   u
      ||||||||   ||||| |||||| ||   u
3'    uucucucg   aggua cuguca au   u
   uau        uug     -      c  caa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349875.1: 508928-508989 [+]
intergenic
Database links

Mature sequence api-miR-281

Accession MIMAT0014134
Sequence

40 - 

ugucauggaguugcucucuuu

 - 60

Get sequence
Evidence by similarity; MI0000366

References

1
"Computational Identification of MicroRNA Homologs from Acyrthosiphon pisum (Pea Aphid)" Sathyamurthy G, Swamy NR J. Comp. Intell. Bioinf. 2:109-119(2009).