Stem-loop sequence aae-mir-92a

AccessionMI0013445 (change log)
DescriptionAedes aegypti miR-92a stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention aae-mir-92a
(8 sentences)

Stem-loop
   aa         c   ac       g    c   -  -ga a 
5'   ucuacgcau ggu  ggacagg gcaa auu gu   c u
     ||||||||| |||  ||||||| |||| ||| ||   |  
3'   aggugcgua ccg  ccuguuc cguu uaa cg   g u
   ug         u   gc       a    a   u  aaa u 
Get sequence
Deep sequencing
20028 reads, 950 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.116: 1267202-1267283 [+]
intergenic
Database links

Mature sequence aae-miR-92a-5p

Accession MIMAT0015369
Previous IDsaae-miR-92a*
Sequence

12 - 

cgguacggacaggggcaacauu

 - 33

Get sequence
Deep sequencing2110 reads, 2 experiments
Evidence experimental; 454 [1]

Mature sequence aae-miR-92a-3p

Accession MIMAT0014228
Previous IDsaae-miR-92a
Sequence

52 - 

uauugcacuugucccggccua

 - 72

Get sequence
Deep sequencing17917 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).