Stem-loop sequence aae-mir-305

AccessionMI0013459 (change log)
DescriptionAedes aegypti miR-305 stem-loop
Gene family MIPF0000158; mir-305
Literature search

2 open access papers mention aae-mir-305
(8 sentences)

Stem-loop
   aa     -     cu u         u  g     -cug    u 
5'   uguca caugu  a uguacuuca ca gugcu    guug u
     ||||| |||||  | ||||||||| || |||||    ||||  
3'   acagu gugua  u acaugaggu gu cacgg    uagc u
   ug     c     au c         u  a     ccca    u 
Get sequence
Deep sequencing
36145 reads, 1.8e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.24: 495587-495674 [+]
intergenic
Clustered miRNAs
< 10kb from aae-mir-305
aae-mir-275supercont1.24: 486536-486618 [+]
aae-mir-305supercont1.24: 495587-495674 [+]
Database links

Mature sequence aae-miR-305-5p

Accession MIMAT0014249
Previous IDsaae-miR-305
Sequence

15 - 

auuguacuucaucaggugcucugg

 - 38

Get sequence
Deep sequencing30790 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-305-3p

Accession MIMAT0014250
Previous IDsaae-miR-305*
Sequence

53 - 

cggcacauguuggaguacacuua

 - 75

Get sequence
Deep sequencing5354 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).