Stem-loop sequence aae-mir-92b

AccessionMI0013527 (change log)
DescriptionAedes aegypti miR-92b stem-loop
Gene family MIPF0000013; mir-25
Literature search

2 open access papers mention aae-mir-92b
(7 sentences)

Stem-loop
       -cgaa         u   uu    cc     -  gaau 
5' gcuc     uguaggucg gac  gugc  guuug cu    u
   ||||     ||||||||| |||  ||||  ||||| ||     
3' cgag     acguccggc cug  cacg  uaaac gg    u
       aaccg         c   uu    -u     u  uaau 
Get sequence
Deep sequencing
18229 reads, 850 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.116: 1319150-1319232 [+]
intergenic
Database links

Mature sequence aae-miR-92b-5p

Accession MIMAT0014321
Previous IDsaae-miR-92b*
Sequence

12 - 

aggucgugacuugugcccguuug

 - 34

Get sequence
Deep sequencing326 reads, 2 experiments
Evidence experimental; 454 [1]

Mature sequence aae-miR-92b-3p

Accession MIMAT0014322
Previous IDsaae-miR-92b
Sequence

52 - 

aauugcacuugucccggccugc

 - 73

Get sequence
Deep sequencing17903 reads, 2 experiments
Evidence experimental; 454 [1]

References

1