Stem-loop sequence ghr-MIR479

AccessionMI0013545 (change log)
DescriptionGossypium hirsutum miR479 stem-loop
Gene family MIPF0000104; MIR171_2
Literature search

4 open access papers mention ghr-MIR479
(7 sentences)

Stem-loop
   g        g   c  c                  au   auu  gau 
5'  gaggagua aca ga gugauauugguucggcuc  cuu   gu   u
    |||||||| ||| || ||||||||||||||||||  |||   ||    
3'  uuuuucgu ugu cu cacuauaacuaagccgag  gaa   ua   a
   u        a   a  -                  cg   cuu  aaa 
Get sequence
Deep sequencing
2 reads, 1.74e+04 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ghr-miR479

Accession MIMAT0014338
Sequence

17 - 

cgugauauugguucggcucauc

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19889219 "Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L.)" Pang M, Woodward AW, Agarwal V, Guan X, Ha M, Ramachandran V, Chen X, Triplett BA, Stelly DM, Chen ZJ Genome Biol. 10:R122(2009).