Stem-loop sequence ghr-MIR827a

AccessionMI0013548 (change log)
DescriptionGossypium hirsutum miR827a stem-loop
Gene family MIPF0000863; MIR827_2
Literature search

9 open access papers mention ghr-MIR827a
(12 sentences)

Stem-loop
        u  --u    ug        u              --       - aucucgccaauucuuuguucaagcaguu 
5' augca ug   ugaa  uguuuguu auggucaucuaagc  cauuuuu c                            u
   ||||| ||   ||||  |||||||| ||||||||||||||  ||||||| |                             
3' uacgu au   acuu  acaaacaa uaccaguagauuug  guaaaga g                            u
        u  ucu    ca        c              ua       c cccacaucagauagccaagcuaauaggu 
Get sequence
Deep sequencing
244 reads, 6.1e+05 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ghr-miR827a

Accession MIMAT0014341
Sequence

118 - 

uuagaugaccaucaacaaaca

 - 138

Get sequence
Deep sequencing55 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19889219 "Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L.)" Pang M, Woodward AW, Agarwal V, Guan X, Ha M, Ramachandran V, Chen X, Triplett BA, Stelly DM, Chen ZJ Genome Biol. 10:R122(2009).