Stem-loop sequence ghr-MIR827b

AccessionMI0013549 (change log)
DescriptionGossypium hirsutum miR827b stem-loop
Gene family MIPF0000863; MIR827_2
Literature search

8 open access papers mention ghr-MIR827b
(10 sentences)

Stem-loop
      -uu    -uu   gaaa     u  --u    ug        u              --       - aucucgccaauucuuuguucaagcaguu 
5' cuu   ucuu   cau    augca ua   ugaa  uguuuguu auggucaucuaagc  cauuuuu c                            u
   |||   ||||   |||    ||||| ||   ||||  |||||||| ||||||||||||||  ||||||| |                             
3' gaa   agaa   gug    uacgu au   acuu  acaaacaa uaccaguagauuug  guaaaga g                            u
      uuu    cuu   -aac     u  ucu    ca        c              ua       c cccacauaagauagccaagcuaauaggu 
Get sequence
Deep sequencing
270 reads, 6.66e+05 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ghr-miR827b

Accession MIMAT0014342
Sequence

136 - 

uuagaugaccaucaacaaaca

 - 156

Get sequence
Deep sequencing55 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19889219 "Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L.)" Pang M, Woodward AW, Agarwal V, Guan X, Ha M, Ramachandran V, Chen X, Triplett BA, Stelly DM, Chen ZJ Genome Biol. 10:R122(2009).