Stem-loop sequence ghr-MIR827c

AccessionMI0013550 (change log)
DescriptionGossypium hirsutum miR827c stem-loop
Gene family MIPF0000863; MIR827_2
Literature search

8 open access papers mention ghr-MIR827c
(10 sentences)

Stem-loop
        --uu uu   ug        u              --       - aucucgccaauucuuuguucaagcaguu 
5' augca    g  gaa  uguuuguu auggucaucuaagc  cauuuuu c                            u
   |||||    |  |||  |||||||| ||||||||||||||  ||||||| |                             
3' uacgu    c  cuu  acaaacaa uaccaguagauuug  guaaaga g                            u
        uauu uc   ca        c              ua       c cccacaucagauagccaagcuaauaggu 
Get sequence
Deep sequencing
244 reads, 6.1e+05 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ghr-miR827c

Accession MIMAT0014343
Sequence

118 - 

uuagaugaccaucaacaaaca

 - 138

Get sequence
Deep sequencing56 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19889219 "Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L.)" Pang M, Woodward AW, Agarwal V, Guan X, Ha M, Ramachandran V, Chen X, Triplett BA, Stelly DM, Chen ZJ Genome Biol. 10:R122(2009).