Stem-loop sequence cqu-mir-999

AccessionMI0013573 (change log)
DescriptionCulex quinquefasciatus miR-999 stem-loop
Gene family MIPF0000852; mir-999
Stem-loop
   cc    a   g              g    ga    a     cau 
5'   gguc ccc cagggacgcggucu gcag  aaua uuugg   u
     |||| ||| |||||||||||||| ||||  |||| |||||    
3'   cuag ggg guuucugugucaga uguc  uugu aaacu   a
   uc    c   a              a    aa    -     uag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.14: 96862-96952 [+]
intergenic
Database links

Mature sequence cqu-miR-999

Accession MIMAT0014370
Sequence

56 - 

uguuaacuguaagacugugucu

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).